Thuis
Contacten

    Hoofdpagina


Pcr technieken. Op zoek naar twee resisteniegenen van Solanum Tuberosum, 4 +2 rassen

Dovnload 344.71 Kb.

Pcr technieken. Op zoek naar twee resisteniegenen van Solanum Tuberosum, 4 +2 rassen



Datum10.01.2019
Grootte344.71 Kb.

Dovnload 344.71 Kb.

PCR technieken. Op zoek naar twee resisteniegenen van Solanum Tuberosum, 4 +2 rassen.
______________________________________________________________
Klas 11A/B/C periode biologie, Rudolf Steinercollege, Haarlem december 2014.

onder begeleiding van M. Hogewoning, B.v. Zweeden.


SAMENVATTING

Bij planten van de familie Solanum is bekend dat zij beschikken over zogenaamde resistentiegenen tegen Phytophtora Infestans. Deze genen die in hedendaagse cultivars van aardappelen lijken te zijn verdwenen, zijn nog volop aanwezig in wilde aardappelplanten en planten van de nachtschadefamilie.

In dit practicum, uitgevoerd door klas11 van het Rudolf Steiner College, Haarlem, worden zes aardappelrassen getest op de aanwezigheid van twee resistentiegenen. Daarnaast worden deze uitkomsten vergeleken met de claims van de leverancier van de (poot)aardappelen. Door bederf van de in de vriezer geconserveerde bladeren van Solanum, bleken bederf een verstorende factor van belang. Opvallend was dat de verse groenten soms wel response gaven.



INLEIDING

In dit practicum wordt onderzocht of de in de zes rassen (Melody, CERISA, Agata, Meerlander en Tomaat en Aubergine) de Resistentiegenen R1 en R3a aanwezig zijn.

Het resistentie gen R3a is terug te vinden in de ncbi-database m.b.v URL:

http://www.ncbi.nlm.nih.gov/nuccore/AY849382.1 . Resistentiegen R1 wordt genoemd in een voor scholen ontwikkeld practicum door de WUR, Wageningen. Helaas vermeldde men niet de herkomst van de gebruikte primers.

De leerlingen zijn in dit practicum op zoek naar de aanwezigheid van deze twee genen.
METHODEN EN TECHNIEKEN

In dit practicum werd gebruik gemaakt van de Phire-Plant PCR-mix, code F130. Hierbij werden 2-3 mm2 grootte samples van het bladmateriaal van de aardappels in tabel 1.0 en gecrushd met een losse Finn-tip in een oplossing van 20 uL Dilution-Buffer. Nadat deze buffer min 1 minuut had ingewerkt, werden deze gevortexted en bij 15000 rpm gecentrifugeerd.


Van deze samples is 0,6 uL overgenomen in een nieuw 0.2ml ep waarin achtereenvolgens is toegevoegd: 8 uL Dnase-vrij water, 10 uL PCR-buffer (dNTP's, MgCl2), 0.6 ul DNA-Taq-polymerase en 0,6 uL primeroplossing A en B (Zie tabel 2.0)

Na opnieuw vortexen en centrifugeren werden de samples in de PCR-machine gedaan (Techne Cyclo-gene 9600) en gerund volgens het protocol opgesteld in tabel 3.0.

Hierna werd van elk monster 15 uL genomen en onder toevoeging van 6 uL loading dye (R631) geladen in een 2% agarose gel onder toevoeging van 0.6 uL EtBr opdat het DNA met UV-licht te detecteren is.

Als controle voor de werkzaamheid is ook een sample genomen van Afrikaan, onder toevoeging van de door Phire-Plant geleverde control-primer die voor amplificatie zorgt van het chloroplast DNA.



Aardappelras/ Plantensoort

Resistent volgens leverancier

MELODY




CERISA




AGATA




MEERLANDER
















Aubergine




Tomaat




Tabel 1.0. Gebruikte aardappelrassen en plantensoorten.



Locus

Locus




Primer

Tm*

Tm

Alleles

size

Genbankno

R1F2


R1-A





GAGTCGGTTGTCAAGTCAG

51.1







269

JN609619.1

R1R2

R1-B




GCATATCTTCCGCATCAGT


50.6







269

JN609619.1

R3aF2


R3-A





AGATTGTTGGTGGTGAGAAT

50.1


56

1

293 bp

AY849382.1

R3aR2


R3-B





AGGAAGTGATTGGAGATTAGG

50.2

56

1

293 bp

AY849382.1

Tabel 2.0, NieuwePrimers gebruikt in dit practicum vastgesteld met Primer Premier v 6.0 (okt 2014)
RESULTATEN
De resultaten zijn gegroepeerd rond de runs van de electroforese. Hierbij is gebruik gemaakt van de lettercodering van de leerlingen. Voor de controle extra bepaling uitgevoerd met primer R3a op Tomaat alsmede een Control-primer op Tomaat.
Uit tabel 3 blijkt wat de uitkomst was van deze test. Foto's van de gel-electroforese, zie figuur 1.


Wie

code

Getest RAS/Groente

R3a amplicon

R1 amplicon

Pepijn/Kjell

A

niet genoteerd??

?

?

Amin/Riemer

B

MELODY

 

geen R1-gen

George/Thijs

C

CERISA

 Geen R3a-gen

 

Steven/Lev

D

AGATA

 

 Geen R1-gen

Donne/Mabel

Z

AUBERGINE

Heel byzonder!!!
drie fragmenten!!!!


 

Cecile/Maud

F

CERISA

Aanwezigheid R3a gen

 

Kim/Sanne/Giuliette

G

AUBERGINE

 

 Geen R1-gen

Daan/Lucas vH

H

MEERLANDER

Geen R3a gen

 

Tobias/Femke

K

AGATA

 

 Geen R1-gen

Wilmar/Ilsa

L

MEERLANDER

?

?

Mark/Tom

M

TOMAAT

 

 Vreemde uitslag. (T3a

Lucas/Bouwewijn

P

TOMAAT

Gen R3a aanwezig

 

Sam/Kamiel

Q

niet genoteerd??

 300 bp fragment

300 bp fragment???

Tijn/Jesse

S

AUBERGINE

 

 DNA smear.

 Bart

 

Tomaat-controle

300 bp fragment.

 

Bart




Tomaar r#a

293 bp fragment.




Tabel 3.0 Groepen leerlingen en hun plant-keuzen + resultaten

FOTO-MATERIAAL AGAROSE-GEL



Uit deze resultaten blijkt dat

Lane A: Geen resultaten

Lane B: idem

Lane C: Idem

Lane D: Idem

Lane Z: drie fragmenten. op ca 270,350 en 400

Lane F: Twee fragmenten op ca 380, ca 300

Lane G Geen resultaten

Lane H: Geen resultaten

Lane K: Geen resultaten

Lane L: Geen resultaten

Lane M: DNA-Smear. Gaat iets mis met primers?

Lane P: Fragment op 300-350

Lane Q: Fragment op 300-350

Lane S: DNA-Smear. Gaat iets mis met primers?

Lane Tc: Tomaat Control. PCR werkt wel.

Lane T:R3a: fragment rond de 300 bp.

CONCLUSIE

Op basis van deze experimenten die nu gehouden zijn valt op dat enkele lanes erg duidelijk zijn: (Z, F, P, en Q). Tomaat R3a wasbij mj al bekend dat ie werkt. Dus in lane P is 100% zeker goed. Ook lane van Mark en Tom klopt uit eerdere metingen: het R1-gen ontbreekt in Tomaat!

De analyse van de overige lanes neem ik voor kennisgeving aan: er is nog niet eerder onderzoek aan gedaan. Dus volgend jaar kunnen we nog eens analyseren.

Bijlage 1. Protocollen

Gevolgd Protocol:

1. Het maken van de gel:

1. 25 ml 10X TBE buffer

2. Voeg toe tot 250 ml met auqadest

3. Hiervan 80 ml genomen voor de gel. Toevoegen 1,6 gr agarose (2%)

4. 45 sec magnetron -> swirl -> 45sec magn. -> swirl-> 30 sec magn.

5. Cool down

6. 6 uL EtBr erbij (vanuit 1% flesje)

7. Zijkantjes goed vastzetten en gel gieten bij net niet pijn-temperatuur.

Geen bellen!

8. Als de zaak gestold is: Overgieten met de rest van de buffer.

Totaal zit erin de bak 300-350 ml TBE buffer.

3. DILUTED: Per sample-materiaal:

1. 0.2 epje

2. 20 uL Dilutionbuffer
3. Crush 2 mm2 met pipetpunt.

4. vortex kort 10 sec

5. centrifuge 30 sec

6. Laat even staan 2 min.

7. Neem 0.6 uL supernatant.

8. 0.2 epje

9. 10 uL PCR buffer

10. 0.6 uL primer A en 0.6uL primer B

11. 0.6 uL Polymerase

12. voeg die 0.5 uL supernatant toe.

13. Vul met water aan tot 20 uL

13. vortex en centrifugeer beide kort ca 20 sec.

13. Laat 5 min staan.
4. PCR programma 40:

fase 1: 15 min 98 oC

fase 2: 30 sec 98 oC

30 sec 51 oC (Volgens literatuur)

60 sec 72 oC

herhaal hierna nog 39 X

fase 3: 5 min op 72 oC

5. DNA 50 bp Ladder:

1. Neem 0.2 ml epje

2. Voeg 3.0 uL DNA-ladder toe

3. Voeg 3.0 uL Loading dye toe #R0631

4. Voeg nog 12 ml H2O toe. Samen 18 uL Is meer dan genoeg voor één gel.


6. Gel electroforese

1. Nadat de PCR klaar is, wordt van de epjes 1 tm 8 15 uL genomen en toevoegen 5 uL loading dye. Vortex en centrifuge kort.



2. Laden van 20 uL van elk monster in de gel:

  • Pepijn/Kjell A niet genoteerd
  • George/Thijs C CERISA
  • Donne/Mabel Z AUBERGINE
  • Cecile/Maud F CERISA
  • Kim/Sanne/Giuliette G AUBERGINE
  • Tobias/Femke K AGATA
  • Mark/Tom M TOMAAT
  • Sam/Kamiel Q niet genoteerd
  • Tijn/Jesse S AUBERGINE
  • Tomaat-controle 300 bp fragment.
  • Zijkantjes goed vastzetten

  • Dovnload 344.71 Kb.